Get help from the best in academic writing.

Southern Blot Technique to Detect the Ultrabithorax Gene

Using the Southern Blot Technique to Detect the Ultrabithorax gene in the Genomic DNA of the Drosophila melanogaster and the pET19 – Ubx plasmid Post Digestion by BamHI, NdeI, and BanII Restriction Enzymes
Abstract:
The Southern blot technique is used to detect targeted DNA sequences in DNA containing samples. In order to run the sample on an agarose gel the large sample of DNA is initially digested using restriction enzymes to provide smaller fragments of the DNA sequence. The loading dye serves as a label to detect the DNA fragments under a UV light to measure the band length of travel. In our specific experiment the Southern blot technique was used to detect the Ubx gene from the Drosophila melanogaster and pET19 – Ubx plasmid. If the restriction enzymes properly digested the the DNA from the Drosophila melanogaster fly, then under the colorimetric probe detection we are able to view and measure the band lengths to verify whether or not the Ubx gene is present in the DNA sample of interest. The experiment produced bands for the lanes loaded with the sample containing plasmid DNA, however bands for Drosophila melanogaster genomic DNA were not observed, but could potentially be due to a multitude of reasons discussed later, rather than the lack of genomic DNA being present altogether.
Introduction:
Edward Southern was successful in devising a method in which specific DNA sequences were detected to determine whether the sequence contained targeted genes of interest (Pattison, 2019). The Southern blot forms the basis of many different types of techniques used in the scientific community today, and although the need for using the original Southern blot technique to to single out the gene of interest in the DNA of an organism has lessened, majority of the modern day techniques are derivatives from the science behind the Southern technique.
The Southern blot technique also helps detect various genes specific to diseases that in turn allow for scientists and medical professionals to help with early diagnosis and understanding of the particular disease. One such usage can be seen in the 2015 study of Facioscapulohumeral dystrophy which scientists have learned can be identified by the lower count of D4Z4 arrays (Vasale et. al, 2015). Detection of this specific gene allows for medical professionals to diagnose patients with FSHD1 (Facioscapulohumeral dystrophy). The Southern blot technique has been an essential tool in this type of diagnosis to study the contractions of this particular gene on chromosome 4 (Vasale et. al,2015). Similarly scientists have used the Southern blot technique to learn more about diseases and disorders such as the Fragile X syndrome. The number of cytosine – guanine – guanine set has been directly linked to the likelihood of this syndrome being present in a patient (Chen et. al, 2010). Although currently scientists are working on using PCR technology in hopes of attaining for accurate data in a more efficient manner, the Southern blot technique has formed the basis of the current knowledge base about the disorder. The Southern blot technique has not always remained the same in laboratories. In fact, many scientists use hybridized versions of the technique for certain studies. One such study was conducted in 2013 to study a C9ORF72 locus containing a repeated hexanucleotide expansion of GGGGCC (Buchman et. al, 2013). A hybridized Southern blot protocol was used in hope to combat the limitations presented by the basic technique and PCR protocols. The study was conducted in hope of attaining a better understanding of the gene, since its presence had previously been noted in a significant number of patients with amyotrophic lateral sclerosis (Buchman et. al 2013). The Southern blot technique forms the basis in advanced knowledge regarding the diagnosis and treatment of many diseases such as these, and through hybrid versions and techniques based off the Southern blot, the field of biology is growing its knowledge base every year.
Interestingly the Southern, northern, and western blot were created around the same timeline in history. The Southern blot being the first, provided a fundamental basis for the advancements of the northern and western blot technique. The basic differences between the three techniques would be associated with the type of detection in each blot. The Southern blot technique is used to detect DNA sequences, while the northern blot technique focuses on detecting RNA sequences and finally the western blot technique focuses on detecting protein sequences. A similarity between Southern and northern blot technique is that both use the method of capillary transfer, while on the other hand the western blot technique uses electric transfer (Mahmood, 2012).
This experiment was conducted in order to understand the fundamentals behind the Southern blot technique and to detect the Ultrabithorax gene of the Drosophila melanogaster fly and the pET19b – Ubx plasmid. In order to prevent non specific binding from the probe, dried milk was used – which resulted in the specific binding of DNA sequences and the probe. It was hypothesized that the Drosophila melanogaster genomic DNA would not present bands in the lanes that contained genomic DNA because the bands are too large to present themselves on the gel. The plasmid DNA, however, was predicted to present bands in the wells loaded with this sample. Using digoxigenin helps detect the Ubx gene on the Southern blot, which can in turn allow for determination of whether or not Ubx is present. The probe sequence that was used for the experiments is as follows:
5’ CCTCTCTCGCTGGGCATGAGTCCCT 3’
The restriction enzymes that were used in this experiment are BanII, BamHI, and BanII/NdeI. The BanII was expected to cut the genomic DNA in more than one place, which would indicate that the expected band size would be smaller than the genomic DNA that was cut with BamHI. The BamHI, on the other hand, was expected to cut the DNA in only one place. And finally the NdeI was expected to cut the genomic DNA in only one place. The lane with only the BamHI was expected to cut the DNA at 6882 base pairs; the lane with only NdeI was expected to cut at 1173 base pairs; the lane with only BanII was expected to cut at 14 base pairs, 813 base pairs, 1123 base pairs, and 4932 base pairs; the lane with BamHI and NdeI was expected to cut at 1177 base pairs, and 5705 base pairs; and the lane with BanII and NdeI was expected to cut at 14 base pairs, 278 base pairs, 813 base pairs, 845 base pairs, and 4932 base pairs.
Which type of enzyme is being used with pET19 – Ubx plasmid?
What is the resulting expected size of the band?
When using BamHI
Expected band size is 6882 base pairs.
When using NdeI
Expected band size is 1173 base pairs.
When using BanII
Expected band sizes are 14 base pairs; 813 base pairs; 1123 base pairs; and 4932 base pairs.
When using NdeI and BamHI
Expected band sizes are 1177 base pairs, 5705 base pairs.
When using NdeI and BanII
Expected band sizes are 14 base pairs, 278 base pairs, 813 base pairs, 845 base pairs, 4932 base pairs.
Table 1: These are the band sizes that can be expected when using the various different restriction enzymes to cleave pET19 – Ubx plasmid.
Materials and Methods:
All materials and methods were conducted according to Dr. Pattison’s protocol. The protocol is cited as follows : Pattison, D. 2015. Southern Blotting: Detection of the Ultrabithorax (Ubx) gene of Drosophila melanogaster. Houston: University of Houston. It is important to note the probe sequence for the protocol and for this experiment the sequence was:
5’CCTCTCTCGCTGGGCATGAGTCCCT 3’.
Certain deviations were taken from the protocol. The wells designed for the agarose gel had smaller comb sizes, and therefore 15 µl of solution from each tube were added into the wells instead of the 20 µl stated in the protocol. Certain deviations were also made to the part of the protocol pertaining to the colorimetric probe detection method which are as follows. The protocol calls for the use of 100 ml of each type of buffer used to wash the membrane, but instead 40 ml were used to wash the membrane with Buffer I, Buffer II, and the wash buffer. Along with this, the antibody/enzyme solution (at a ratio of 1/5000 concentration) amount was lessened from 40 ml to 32 ml that were used. The agarose gel is stated to be 0.8 % in the protocol, but in the experiment we used a 1% agarose gel instead.
Results:
The purpose of this experiment was to detect the UBX gene in D. melanogaster using the Southern blotting technique. Figure 1 displays the results when the samples were run on a 1% agarose gel. The expected band sizes are written for lanes 5, 6, 7, and 8. Starting at land 5, there was a band at 6882 base pairs when BamHI was used to digest the pET19 UBX in lane 5. In lane 6 the band size was 1123 base pairs which contains BanII to digest pET19 UBX, 845 base pairs in lane 7 with two restriction enzymes which were BanII and NdeI. Lastly, lane 8 contained BamHI and NdeI to digest the pET19 UBX DNA which appeared at band size 1177 base pairs. The smear that formed in lanes 2-3 was expected due to the amount of DNA loaded in the wells. At the bottom of these three lanes there are RNA fragments which we don’t account for because our focus are the DNA fragments.

Figure 1: Agarose gel used to load samples for agarose gel electrophoresis. Lane 1: 12 ?l Promega ladder. Lane 2: 15 ?l of content from Tube 1 which contained water, genomic DNA, CutSmart Buffer, and BamHI. Lane 3: 15 ?l of content from Tube 2 which contained water, genomic DNA, CutSmart Buffer, and BanII. Lane 4: 15 ?l of content from Tube 3 which contained water, genomic DNA, CutSmart Buffer, NdeI and BanII. Lane 5: 15 ?l of content from Tube 4 which contained water, pET19-UBX, CutSmart Buffer, and BamHI. Lane 6: 15 ?l of content from Tube 5 which contained water, pET19-UBX, CutSmart Buffer, and BanII. Lane 7: 15 ?l of content from Tube 6 which contained water, pET19-UBX, CutSmart Buffer, NdeI, and BanII. Lastly, lane 8: 15 ?l of content from Tube 7 which contained water, pET19-UBX, CutSmart Buffer, BamHI, and NdeI.

Figure 2: Positively charged nylon membrane in which DNA was transferred to detect the location and size of the UBX gene. Lane 4 that contained NdeI and BanII restriction enzyme displayed a band at 682 base pair. Lane 5 contained BamHI enzyme which displayed a band at 1123 base pair. Lane 7 displayed a band at 845 base pairs with enzyme
Discussion:
Our predicted hypothesis was correct in that no visible bands were seen in the region of the gel where Drosophila melanogaster genomic DNA was loaded, but bands were observed in the region of the gel where plasmid DNA was loaded into the wells. After we ran the gel, there was an observable smear in lane 2, lane 3, and lane 4. Although there are no visible bands present, this does not necessarily mean no genomic DNA is present, rather the genomic DNA bands from the Drosophila melanogaster are too large to be visible on the gel.
The noticeable smear on the gel could be present due to a wide array of reasons. While transferring the samples in the tubes into the wells, the protocol had directed us to add 20 ?l of the sample from the tube into the wells. Although we did this for the first and second lane, we realized that this was causing the wells to overflow and opted to deviate from the protocol and start adding 15 ?l instead. This overloading of the wells could potentially cause for the smear observed on the gel. This could potentially pose to be an issue since there is a chance that not enough DNA plasmid is being transferred into the wells from the tubes. The wells that were loaded with 20 ?l caused for an overflow and resulted in a minute immeasurable amount of sample to flow into the buffer. Since we saw bands on our membrane, it is safe to assume that DNA was present, but not in enough quantity to show bands on the gel for the lanes that contained pET19 – Ubx.
The bands that were present for the pET19 – Ubx infused sample wells. The band present for the well with pET19 – Ubx and BamHI was at 6882 base pairs; the band present for the well with pET19 – Ubx and BanII was at 1177; the band present for the well with pET19 – Ubx and NdeI / BanII was at 1123 base pairs; and finally the band present for pET19 – Ubx and BamHI and NdeI was at 875 base pairs. As stated before, no visible bands were observed for the lanes that were loaded with the genomic Drosophila melanogaster DNA, but this does not necessarily equate to the fact that no DNA is present in these lanes. The bands for the Drosophila melanogaster genomic DNA are too large to be shown on the gel.
To conclude, we were successful in using the Southern blot technique to detect the Ubx gene the pET19 – Ubx plasmid. With the exception of a few errors and unexpected deviations that we were forced to make while conducting the experiment, we were successful in following the protocol and being able to observe bands on our membrane. The plasmid was cleaved as expected, and the size of the base pairs were as predicted. In the future researchers could potentially design experiments based on this protocol that can help detect certain DNA fragments that are found to be common in cancer cells, and in turn could help answer some hanging questions the scientific community has regarding this disease today.
References:
Vasale, J., Boyar, F., Jocson, M., Sulcova, V., Chan, P., Liaquat, K., . . . Higgins, J. (2015, August 11). Molecular combing compared to Southern blot for measuring D4Z4 contractions in FSHD. Retrieved February 02, 2019.
Chen, L., Hadd, A., Sah, S., Filipovic-Sadic, S., Krosting, J., Sekinger, E., . . . Latham, G. (2010, September 5). An Information-Rich CGG Repeat Primed PCR That Detects the Full Range of Fragile X Expanded Alleles and Minimizes the Need for Southern Blot Analysis. Retrieved February 3, 2019.
Buchman, V., Cooper-Knock, J., Connor-Robson, N., Higginbottom, A., Kirby, J., Razinskaya, O., . . . Shaw, P. (2012, August 1). Simultaneous and independent detection of C9ORF72 alleles with low and high number of GGGGCC repeats using an optimised protocol of Southern blot hybridisation. Retrieved February 2, 2019
Kimura, M., Aviv, A., Stone, R., Hunt, S., Skurnick, J., Lu, X., . . . Harley, C. (2010, September 2). Measurement of telomere DNA content by dot blot analysis. Retrieved February 2, 2019.
Mahmood, T.,

Research into Epigenetic Based Cures for Cancer

Introduction
Cancer is one of the most prominent diseases of modern times that a consistently effective cure has not been discovered for. Those born after 1960 have a 50% chance of being diagnosed with any given type of cancer in their lifetime; inferring that almost everyone will be affected by cancer during their lives (Cancer Research UK, n.d.). However, only half of people diagnosed with cancer survive their disease for ten years or more (Cancer Survival Statistics, n.d.). This shows that the current treatments for cancer are not consistently successful; nor directly hitting the core cause of the cancer occurring. Epigenetic based cures could begin to target the root cause of cancer (precision cancer medicine) and be revolutionary in solving this modern day global epidemic that is causing the second highest amount of death each year (Who, n.d.).
The Greek word ‘epigenesis’ summarises the study of the progression of genetic processes from a fundamental cell through development of undifferentiated cells to a fully functional organism. ‘Epi’ meaning upon or in addition to and ‘genesis’ referring to origin or creation; in combination meaning on top of origin which we now know to be the addition of epigenetics to our base script of DNA. Conrad H. Waddington originally coined the term epigenetics in 1942 to mean the impression on development of various genetic processes (C.H., 1942).Waddington described the concept of passing on genetics similar to a ball rolling in to different valleys on a landscape; it only takes a small ‘nudge’ from the environment for the genetics to be changed into a different valley (representing a different route the genes could take). He first put this theory into practice on his initial experiment into Drosophila (fruit flies) where he placed the flies under stress-causing heat shock which led to changes in development like change in eye colour and wing defects. These defects were then passed onto offspring despite them not having personally suffered the heat shock – showing that environmental factors affecting a parent can change their genetics permanently and in a way that can be inherited (C.H.Waddington, 1953).
Our bodies are made up of over 30 trillion cells, inside most of these cells is a nucleus which contains our genetic material (our DNA). Deoxyribose nucleic acid (DNA) codes for every aspect of our phenotype and is a continuous script determining all of our characteristics. This script was previously thought to be expressed exactly as it is written but scientists have now come to realise this is untrue. Each cell nucleus contains two metres of DNA into an area which is 6 micrometres across; the only way this could fit is it was coiled repeatedly (How Long is Your DNA, 2018). It is coiled around proteins called histones which not only help to compact the DNA but decide whether the genes will be switched ‘on’ or ‘off’. This switching is fundamental in epigenetics. It is important to recognise that epigenetics is not a process that occurs to increase the amount of defects in an organism, it is completely necessary in order for us to function e.g. to differentiate our cells – skin cells vary greatly from our white blood cells in size, function etc. but contain the exact same DNA instructions to work off of.
Epigenetics decides which genes are expressed and which genes are not. This occurs when genes are methylated or not methylated; if a methyl group is attached to the DNA sequence the RNA polymerase cannot read it and therefore not use that part of the gene, if the gene is not methylated then it will be read and transcribed (expressed). Whether methylation occurs is affected by many factors including inheritance and environmental factors.
Such as exposure to pollution or availability of food.
Pollution is one of the primary causes of lung cancer causing nearly 1 in 10 lung cancers but it is difficult to create a chain of causation as we are exposed to it in varying degrees due to the change in the harmful chemicals from area to area and the effect altering between people. Miniscule particles in the air (primarily the smallest known as PM2.5 (How air pollution can cause cancer, n.d.)) affects the methyl groups attached to our DNA – research has shown inhaling exhaust fumes correlates with epigenetic changes that impact up to 400 genes (Air Pollution Could Alter Tags on DNA and Increase Risk for Neurodegenerative Disease, n.d.). These epigenetic changes include those which can cause lung diseases such as cancer or neurodegenerative illnesses.
One source of pollution which affects epigenetic changes is one’s exposure to miniscule particles contained in diesel exhaust fumes. Recent research shows that when cells were exposed to traffic-related air pollution from a street in Shanghai the cells began to malfunction and failed to act as normal cells contributing to the development of a neurodegenerative disease. Although the UK has lower levels of pollution internationally compared, it still is not within all of the EU limits. This suggests the importance of Sadiq Khans’ ultra-low emission zone in London especially due to the level of school children who are being exposed to this disease-causing air and have stunted lung development because of this.
Disruption of this epigenetic expression can easily cause cancer as it is an interruption in the transcription and as a result cell replication and division. Cancer cells have unregulated division and continue to replicate beyond the usual number of divisions even if their DNA is disrupted. This overproduction of cells is a tumour. This has been shown by a recent study by Baylor College of Medicine whereby mice had a methyl ‘magnet’ that silenced the gene methylation of the gene ‘p16’ (the regulator of cell division). This interruption led to 27% developing cancer; showing the significant impact of epigenetics on the development of cancerous cells (The Scientist, n.d.). If this process can be manipulated effectively it could have a significant impact on eliminating cancer cells even in the earliest stages by reversing the faulty changes in the epigenome back to the normal positioning.
One of the largest companies occupied on these cures and the concept of ‘precision cancer medicine’ is Dana-Farber/Brigham who have generated a research project – ‘Profile’ – which creates a ‘tumour profile’ from the area from which each individual’s cancer develops and the epigenetic mutations that have occurred to cause the specific type of cancer (Precision Cancer Medicine , n.d.). It registers 447 genetic mutations as well as other alterations in the DNA sequence and uses this to create a personalised treatment. This is used to assist doctors in knowing which drugs or therapies the cancer will react to and even predict how it will act as it develops without treatment present. An example of this is a trial into the treatment of 347 non-small cell lung cancer patients with a specific gene mutation (ALK gene) (Targeted therapy boosts lung cancer outcomes, n.d.). The sufferers received an oral drug (crizotinib) which directly targets the ALK gene by inhibiting the cancers growth and were found to continue treatment for a median of 7.7 months before the disease worsened; in contrast to 3 months for those who undergo traditional chemotherapy (Targeted therapy boosts lung cancer outcomes, n.d.). In 2014 the US Food and Drug Administration approved crizotinib for the treatment of advanced lung cancer – suggesting its potential to be an impactful treatment (Targeted Drugs Get First Test in Early Stage Lung Cancer, 2014). However, crizotinib was not without its flaws as only five percent of non-small cell lung cancer sufferers (the most prominent form of lung cancer) suffer from a mutation in the ALK gene and many of the small percentage treated experienced side effects such as gastrointestinal issues as well as visual disorders and leg swelling (Targeted therapy boosts lung cancer outcomes, n.d.). It also has since been found to possibly cause a hole in the bowel or stomach as well as possible liver failure – these side effects are possibly deadly and occur in up to 1% of those treated. In a separate study, crizotinib was found to have even more promising results as the length of time during which the patients (with the ALK mutation) cancer did not worsen in contrast to those treated with chemotherapy was a significant percentage longer; when taking crizotinib capsules the cancer did not get worse for 10.9 months in contrast to 7 months for those receiving chemotherapy infusions. 127 of the 172 patients in the crizotinib group had tumours shrink, the spread of cancer lessen or even had all signs of cancer disappear as opposed to 75 of the 171 patients receiving chemotherapy having a partial response to treatment (ALK Study Results, 2017). However, for the majority of those treated with crizotinib (also known as Xalkori) they were not cured of the disease as it simply delayed the worsening of the disease for only a few months. As well as this, no significant difference in survival between those treated with Xalkori or those treated with chemotherapy (ALK Study Results, 2017). These trials have only confirmed that by no means is crizotinib a perfect cure. Despite its ability to consistently affect the cancer, in comparison to more traditional drugs such as chemotherapy the damage done to the cancerous cells was significantly less. This suggests that in some cases more traditional drugs (despite their increased negative side effects) can be a more effective option in the cases of some patients. In addition to these issues, crizotinib is impractical to advertise as a treatment for all those suffering from this specific form of lung cancer in countries where there is not a national health service – this is due to the cost of one course of treatment for one patient being £51,000 (NICE, n.d.). For an average income in most countries this would make the drug completely unobtainable and therefore not significant in the global attempt to medicate lung cancer. However, it could be argued that this cost would be cancelled out as those taking it would not have to pay for chemotherapy done in a hospital (which not only incurs the primary cost of the chemotherapy medication but many secondary costs such as staff, a hospital bed, food during their hospital stay etc).
Another major innovator in the epigenetic cure industry is Johns Hopkins Medicine. They are using their scientific research to reprogram the behaviour of cells to act normally as opposed to usual lung cancer treatments which aim to destroy cells (John Hopkins Medicine, 2019). This decreases the level of damage to cells which aren’t being targeted (e.g. non-cancerous cells). This in turn reduces the negative side effects such as nausea and fatigue. Research by Stephen Baylin into this medication showed that it was highly effective for certain patients in creating a more permanent fix for the illness by preventing its growth or destroying the tumours altogether (John Hopkins Medicine, 2019). However, for most patients it didn’t appear to show any effect on the tumours which created a larger debate – what differentiated between those who it did work on and those it was ineffective in treating. Further research into the longer term effects on those it was ineffective in helping showed astounding results; their cancers had miraculously become sensitised to other treatments that were previously unsuccessful. This suggests that the effect of this medication is positive on all patients even if not immediately or in the way that it was predicted to. Whether this drug will be released is still unclear due to the years of rigorous testing it must go through in order to be available for clinical use.
It could be argued that the perspective from which these cures are currently being developed from is too narrow and that scientists should first create a wider database from which to develop more specific conclusions. There is currently no database of what a healthy epigenome is; which makes it far more difficult to identify exactly which epigenetic alteration has caused the disease and therefore what treatment could be used to reverse the cancers growth.
Precision cancer medicine using epigenetic-based medicine is still in its infancy and despite its proven effect on tumours it is hard to suggest how large an impact it may have on the community of cancer treatment due to its huge cost as well as the long term effects of it on health. It also may be hard to distribute to a wide population due to the specificity of each medication as it is not only specific to each cancer it is specific to the gene alteration which caused the disease. There are hundreds of thousands of possible variations and to determine which alteration each person has could increase the price by a significant margin.
Research in other new areas for treatment of cancer are expanding; one of which is the rise of cannabinoid therapy usage. Cannabinoid use is rising in popularity – partially due to the widening legalising of cannabis for both medicinal and recreational use. The political and medical view of cannabis is modernising to a more liberal perspective. Research into the medicinal uses of cannabis originating products such as cannabidiol (CBD) has shown that the chemical has abilities many of which that may be useful in the treatment of cancer. Examples of this include its capability to kill cells and stop cells from dividing; this is of indispensable importance in reducing tumour size and preventing further tumour growth (Cannabis and Cancer, n.d.). However, it is yet to show an ability to distinguish between cancerous and normal cells when acting; this issue has meant cannabinoids have been shown to harm necessary blood vessels. Another flaw of the use of cannabidiol is it has also occasionally seen to even boost cancer cell growth (Cannabis and Cancer, n.d.). One aspect of cannabinoid use that has been proven throughout many studies is its effectiveness in relieving some patients side effects of their illness. Many patients experience nausea, pain and fatigue as a result of either the illness or the harsh treatments needed to cure it. Cannabis has been shown in many diseases including cancer to act as a sort of ‘painkiller’ by reducing many of the most obvious side effects of like nausea and pain. However, one of the largest positives of using this method of treatment is the affordable cost – at 1.94 dollars a day the increase in availability in contrast to the expense of crizotinib.
Works Cited (n.d.). Retrieved from Cancer Research UK: https://www.cancerresearchuk.org/health-professional/cancer-statistics/risk
(n.d.). Retrieved November 28, 2018, from Who: http://www.who.int/news-room/fact-sheets/detail/cancer
(n.d.). Retrieved from NICE: https://www.nice.org.uk/news/article/nice-recommends-crizotinib-first-pill-for-lung-cancer
Air Pollution Could Alter Tags on DNA and Increase Risk for Neurodegenerative Disease. (n.d.). Retrieved January 29th, 2019, from whatisepigenetics: https://www.whatisepigenetics.com/air-pollution-alter-tags-dna-increase-risk-neurodegenerative-disease/
ALK Study Results. (2017). Retrieved December 19, 2018, from Xalkori: https://www.xalkori.com/how-it-works#open-isi
C.H., W. (1942). “The epigenotype”.
C.H.Waddington. (1953, June). JSTOR. Retrieved November 21, 2018, from https://www.jstor.org/stable/2405747?seq=5#metadata_info_tab_contents
Cancer Survival Statistics. (n.d.). Retrieved from Cancer Research UK: https://www.cancerresearchuk.org/health-professional/cancer-statistics/survival#heading-Zero
Cannabis and Cancer. (n.d.). Retrieved 2 12, 2019, from Macmillan: https://www.macmillan.org.uk/information-and-support/coping/complementary-therapies/complementary-therapies-explained/cannabis-oil.html
How air pollution can cause cancer. (n.d.). Retrieved January 29th, 2019, from Cancer Research UK: https://www.cancerresearchuk.org/about-cancer/causes-of-cancer/air-pollution-radon-gas-and-cancer/how-air-pollution-can-cause-cancer
How Long is Your DNA. (2018, November 28). Retrieved from Science Focus: https://www.sciencefocus.com/the-human-body/how-long-is-your-dna/
Precision Cancer Medicine . (n.d.). Retrieved from Dana Farber Cancer Institute: http://www.precisioncancermedicine.org/research-treatment/what-is-profile/
Targeted Drugs Get First Test in Early Stage Lung Cancer. (2014, August 19). Retrieved December 12, 2018, from Dana-Farber: https://www.dana-farber.org/newsroom/news-releases/2014/targeted-drugs-get-first-test-in-early-stage-lung-cancer/
Targeted therapy boosts lung cancer outcomes. (n.d.). Retrieved December 12, 2018, from Dana-Farber: https://www.dana-farber.org/newsroom/news-releases/2013/targeted-therapy-boosts-lung-cancer-outcomes/
The Scientist. (n.d.). Retrieved from https://www.the-scientist.com/news-opinion/epigenetic-changes-can-cause-cancer-37120

[casanovaaggrev]