Get help from the best in academic writing.

Antimicrobial Peptides (AMPs) for Antibiotics

Dhayalini Yoginthran
Antibiotic resistance is something that has been growing in the world, some might even say that we are entering or have already entered a post antibiotic world. It is currently one of the superior concerns in the 21st century, especially in regards to pathogenic microorganisms. Throughout the years, research had allowed for the development of first line antibiotics that were efficacious against infections plaguing the population. Due to resistance build up towards first line agents, second line agents were then used to treat infections, which usually have a broad spectrum in treatment. In some cases pathogens have also acquired resistance towards multiple drugs, one such example would be Staphylococcus aureus (Zainnudin and Dale, 1990).
Antimicrobial peptides (AMPs) are substances produced by animals, bacteria and plants. They are also known as host defence peptides and are a part of the non-specific immune system. Differences between eukaryotes and prokaryotes show the potential of targeted therapy with the use of AMPs . They are dynamic and are of broad spectrum and have shown plausible evidence that they may be used as a new therapeutic agent. AMPs are quite small, have various sequences and lengths. They are also known to be cationic and amphipathic (Hultmark, 2003). They have shown considerable bactericidal activity against both Gram positive and Gram negative strains of bacteria, Mycobacterium tuberculosis, malignant cells as well as viruses that are enveloped (Reddy et al., 2004). AMPs work by the interaction with the membrane of the potential pathogen thus leads to the perturbation of said membrane. The peptide is then inserted into the bilayer of the membrane that causes the displacement of the lipids. The perturbation and the displacement actions render it easy for the peptide to be translocation into the intracellular target of the pathogen.
AMPs are usually derived from coding sequences in a gene, databases of known AMPs have been curated to hold information of AMPs as well as to provide tools to predict possible AMPs that are found in genomes (Fjell et al., 2007). The Antimicrobial Peptide database (APD) is one of the major resource for antimicrobial peptide sequences that have been curated. AMPs from various phylogenetic kingdoms are available, making the prediction of models based on qualitative and quantitative activity easier. In order to bring the development of AMPs into light, certain objectives are to be met. An AMP must be active against the pathogen in which it is targeted against and must have a high therapeutic index. In order to look for a suitable AMP that can act as a broad spectrum antibiotic. A method will be explained to show the screening process to look for one such AMP.
The method would be to employ template based studies. A template AMP will be used to look for peptides that have better antimicrobial activity and also is reduced in toxicity by altering amino acid sequences. In order to elucidate positions of amino acids that are important in antimicrobial activity, a single amino acid in the peptide will be changed, and hence the changes will be studied. Template AMPs that could be used for this would be lactoferrin or magainin. The variety of peptides are designed based on the amphiphilicity and charge of the AMPs and their role in antimicrobial activity. It will be possible to synthesis peptides using a high throughput approach of arrays that is done together with a speedy luminescence assay to portray bactericidal activity. This would lead to us being able to perform a complete substitution method to study the amino acid changes in the desired peptide. Several substitution studies that have been performed have shown that the activity shown by the substituted amino acids differ with regards to the template AMP utilised (Schneider et al., 1995). A linguistic model shall be used to pinpoint patterns in natural peptides (Loose et al., 2006). It is possible that the novel peptide that is constructed based on this will show superiority against models that are generated based on the random shuffling of amino acid sequences. Functionally important patterns of amino acids will be found using this linguistic model. In a previous study conducted by Loose et al (2006), 4 out of 40 designed peptides showcased activity against E. coli and B. cereus at an acceptable concentration.
In order to achieve specificity against the membrane of the pathogen, amino acid residues that contain a positive charge is used on the non-polar side of amphiphatic ??helical AMPs to further strengthen the discrepancy of the peptide when it has to select against prokaryotic and eukaryotic membranes. It is also possible to increase the therapeutic index of the modelled peptide by altering the residues on the known peptide used. It has been demonstrated in a study that computer based drug design has shown that both the haemolytic activity and the therapeutic index has been improved without reducing the antimicrobial activity. In order to find relevant antimicrobial activity, the screening of the AMP should be done against pathogens that are known to cause severe (and possibly fatal) infections.
Since the dawn of the new millennia, approximately 20 new antibiotics have been marketed with even more being in various phases of clinical studies. AMPs have also been designed are in clinical trials, with some of the AMPs showing promise based on the trial results such as AMP hLF1–11 based on lactoferrin and Pexiganan155 based on magainin. There are also AMPs that have failed at the clinical stage, that are owed to several factors. These factors might play a part during the development of this AMP but there are ways to overcome it. One possible problem in the synthesis of this AMP would be the cost of goods required. To reduce that, it is possible to engineer smaller peptides and to utilise approaches that have already been known to give highly potent broad range antibiotics that are able to work in animals. Proteolytic degradation is also another potential problem with designing this AMP. To overcome this problem, it is best to use d-amino acids or artificial analogues of amino acids as well as mimetics that contain a distinct backbone structure. (Choudhary and Raines, 2011). The main issue that poses a problem with the design of this AMP would be toxicity. In order to overcome it, various sequences that are highly active should be created and should be tested for the toxicity or lack of it in animals. Another option would be to use productions that are able to mask the peptide (e.g liposomal formula) until it reaches the target (Desai et al., 2002). The haemolytic toxicity of AMPs are a routine investigation that is performed in the process of drug design. In order to better the algorithms used in designing the AMP, it is of extreme importance that computational prediction of toxicology would be require. Especially in preclinical stages where the toxicological end point of the designed AMP must be identified. Due to there not being sufficient data regarding standardized toxicological data that is specific towards AMPs, machine learning and alerting tools can be used in this aspect of AMP drug design. Multidimensional techniques used in designing have been optimized to be used in combinatorial drug discovery (Fischer et al., 2009). Peptide design that utilises computers would definitely benefit from this. With the advancement of multidimensional techniques, in silico pharmacology that is also used in the design of this AMP would benefit. This AMP and the method used to design it would benefit from studies that have been done previously on natural peptides. Based on previous studies, the disruption of the secondary structure or the usage and modification of the type of amino acid replaced (d-amino acid) has shown that the secondary structure preferred and the biological activity exhibited are not mutually exclusive. In the problem that might occur with the haemolytic activity of this AMO, methylation can be performed without affecting the secondary structure of the AMP as shown in the design of cecropin A–melittin-derived helical AMP (Díaz et al., 2011). The experiments done has shown that the molecular structure can be proportionate towards its antimicrobial activity.
Based on the method utilised above, it is possible for an AMP that has a broad spectrum to be designed and developed, if the criteria needed is met. The possible problems that may occur in the designing of the drug has been discusses and the solutions stated. Designing an AMP will be the hallmark of modern medicine with regards to antimicrobials. As the world enters a post antibiotic era, every avenue should be scoured to produce a cure, and AMPs seem to be a very realistic approach.

Synthesis of Chiral Drug Intermediates

Given the important role of phenylalanine dehydrogenase (PheDH) in the synthesis of chiral drug intermediates and detection of phenylketonuria, suggesting it is significant to obtain a PheDH with special and high activity. Here, a novel PheDH gene, pdh, encoding a BsPDH with 61.0% similarity to the known PheDH from Microbacterium sp., was obtained. The BsPDH showed the optimal activity at 60°C and pH 7.0, and was more stable in hot environment (40-70℃) than Nocardia sp.’s PheDH. Its activity and thermostability could be significant increased by sodium salt, showing the highest activity (138% of the activity) at 3 M NaCl, retaining nearly 100% activity at 6 M NaCl and the residual activity of BsPDH increased from 43% to 77 % after 2 h incubation at 60℃, compared to the absence of NaCl. These characteristics indicating BsPDH possess better thermostability, halophilic and higher salt activation. The mechanism of the thermozyme and high salt-tolerant of BsPDH was analyzed and verified by molecular dynamics simulation. These results provide useful information about the enzyme with high-temperature, thermostability, halophilic, higher salt activation and enantio-selectivity, and the application of molecular dynamics simulation in analyzing the mechanism of these special characteristic.
NAD(H), phenylpyruvate, L-phenylalantne and D-phenylalantne were purchased from Sigma–Aldrich Co. (Shanghai, China). All the other chemicals were analytical chromatographically pure or analytically graded and used without further purification. And they were purchased from Sinopharm Chemical Reagent Co., Ltd. (China). DNA polymerase, restriction Ex TaqTM DNA, endonucleases, T4 DNA ligase and other enzymes were purchased from TaKaRa Co., Ltd. (Dalian, China). Mutan BEST Kit, Ligation solution I, Purification Kit Ver 2.0 and Agarose Gel DNA Fragment Recovery Kit Ver.2.0 were purchased from TaKaRa Co., Ltd. (Kyoto, Japan).
The marine bacterium B. halodurans (the strain number MCCC MCCC 1B00241) was obtained from the Marine Culture Collection of China (MCCC) and cultured at 30 °C in 2216 medium. Escherichia coli BL21 (DE3) and Escherichia coli DH5α (E. coli DH5α) were used as host strains for heterologous expression and choning, respectively.
The specific primers (F-Bn-pdh: GGAATTCCATATGATGCTAACGAAAACGCCAACTGTCAC and R-Bn-pdh: CCCAAGCTTCTATTTACGTAAGTTCCATTTCGGCC; containing NdeI and HindIII sites, underlined, respectively) were employ in amplify the pdh gene by polymerase chain reaction (PCR) under the following steps: the reaction was started at 95 °C (5 min), followed by 30 cycles: 95 °C (30 s), 55 °C (30 s), 72 °C (1min), with a final extension at 72 °C (7 min). Primerstar Max polymerase was implemented to finish this amplification and the reaction was carried out in 40 μL reaction volumes containing 1 μL of each primer, 1 μL of template DNA, 20 μL Primerstar Max and 17 μL sterile ddH2O. For construction a recombinant plasmid to express the BsPDH in BL21 (DE3), the PCR product was purified and cloned into pET-28a ( ) vector with NdeI and HindIII as the restriction enzyme cutting sites, generating pET-28a-pdh. After that, the recombinant plasmids were transformed into E. coli DH5α for the culture and grown at 37 °C. The establishment accuracy was confirmed by sequencing and the positive recombinant plasmids were transformed into BL21 (DE3) for further study.
The recombinant BL21 (DE3) strains were cultured in LB medium (containing 100μg/mL kanamycin) and incubated at 37°C for 12h. Subsequently, the mixture was transferred into fresh LB liquid medium (containing 100μg/mL kanamycin) and cultured at 37°C for 5 h. When OD600 reached 0.6-0.8, the isopropyl-β-d-thiogalactoside (IPTG) was added with a final concentration of 0.1 mM for induce the protein expression, and the mixture was incubated at 22°C for 8 h. Then, the cells were harvested and disrupted by centrifugation at 12,000 rpm for 20 min and resuspended in 100 mM HEPES (pH 7.0) with High Pressure Homogenizer (Niro Soavi, Germany) and the resuspended cells were lysed by sonicating for 10 min at 4°C. After centrifugation at 12,000 rpm for 40 min, the supernatant was applied to an AKTA Prime system equipped with a 10-mL HisTrapTMFF column (GE Healthcare, USA). Finally, the expression and purity of the enzyme was checked by 12% SDS-PAGE according to the method of Laemmli [46] and the protein concentration was calculated using Bradford Protein Assay Kit.
PheDH activity for the reductive amination was assayed at 25 °C by measuring the consumption of NADH at 340 nm (É›=6,220 M-1cm-1) with a Hitachi U-3210 spectrophotometer in the reaction mixture (0.5 ml) containing 100mM glycine-KCl-KOH buffer (pH 10.4), 0.05 mM NADH, 50 mM NH3·H2O-NH4Cl buffer, 20 mM sodium phenylpyruvate, and moderate enzyme. The enzyme activity for oxidative deamination was determined at 25 °C by the reduction of NAD (monitored at 340 nm) with D-phenylalanine or L-phenylalanine as a substrate. The reaction mixture (0.5 ml) contained 50 mM glycine-KCl-KOH buffer (pH 10.4), 2 mM NAD , 20 mM D-phenylalanine or L-phenylalanine, and moderate enzyme. One unit (U) of the enzyme activity is defined as the amount of enzyme catalyzing the formation or consuming of 1μmol NADH per min in the oxidative deamination of L-phenylalanine or reductive amination of phenylpyruvate, respectively, under the standard assay conditions. Specific activity was recorded as units/mg protein.
For the part of the reductive amination, the optimal pH of BsPDH was determined at 25°C in different buffers at pH 4-11, namely 0.2 M acetic acid, sodium acetate buffer (containing 0.2 NH4Cl, pH 4-6.0) and 0.2 M NH3·H2O-NH4Cl buffer (6-11.0). The optimum temperature of BsPDH was determined by incubating the reaction mixtures at different temperatures (0-85℃) under pH 7.0 after pre-incubating the reaction system (without NADH) at corresponding temperatures for 20 min. The thermal stability of the enzyme was assayed under the optimal pH by pre-incubating the BsPDH at temperatures from 37°C to 70°C for 120 min and the residual enzyme activity was measured as described above. The pH stability of the BsPDH was determined while it was incubated at 4°C for 96 h in different buffer systems (pH 6-9.5), and then the remaining activity was measured under the standard. The biochemical characterization of the oxidative deamination of the BsPDH was performed with the same methods, except the buffers were 0.2 M acetic acid-sodium acetate buffer (pH 4-6.0), barbital sodium-hydrochloric acid buffer (6-9.0) and 0.05 M glycine-sodium hydroxide buffer (8.6-11).
The effect of NaCl on the purified BsPDH activity was determined in NH3·H2O-NH4Cl buffer (pH 7.0) or barbital sodium-hydrochloric acid buffer (7.0) containing various concentrations of NaCl (0-6 M). The effect of NaCl on the BsPDH thermo stability was determined by diluting the purified enzyme with 3 and 4 M NaCl for the reductive amination and oxidative deamination, respectively, and then incubating the mixture at 37, 40, 45, 50, 55, 60, 70 and 80 °C for 120 min. For each assay, a control group without NaCl was assayed under the same conditions. The residual activity of BsPDH was measured under standard methods conditions as described above.
The fluorescence spectra were obtained by Jasco Circular Dichroism Chiroptical Spectrometer (CD/ORD, J810, Japan). Using an excitation wavelength of 280 nm, the intrinsic fluorescence was measured. The emission spectra were recorded at the wavelengths from 180 to 280 nm. The samples were pre-incubated for 120 min at 60 °C in 0 and 3 M NaCl, respectively.
The amino acids sequence of the BsPDH was submit to the SWISS-MODEL [1] for search template on the server. Then, the 1leh.1.A and 3vpx.1.A, which share the similarity of 45.01% and 47.01% with the BsPDH, were obtained and used as the template for future study. The PDB file of target protein BsPDH was constructed by manual modeling in EasyModeller4.0 [1].
To study molecular dynamics characteristics of the halophilic BsPDH, the molecular dynamics simulation of three groups of different salt concentrations, 0 M, 1 M, 3 M, were designed, and the atomic number of three groups of experiments were 55222, 53990 and 51530 respectively. Using the CHARM36 force field, atmospheric pressure (101.325 kPa) as the simulation pressure, the temperature of 333 k, and in the side length for 84 Å cubic water, the three systems were molecular dynamics simulations of 15 ns by using the software NAMD [2] and visualization software VMD [3]. The methods, Langevin Piston andLangevin Thermostat were selected to control of pressure and temperature fluctuations. PME [4] was used to calculated the long-range electrostatic forces and non-bonded interactions was calculated by the potential energy truncation with a radius of 1.35nm, for systems using periodic boundary conditions, the use SHAKE algorithm so that the water molecules remain rigid. Using periodic boundary conditions for the systems and the SHAKE algorithm makes use of keep the water molecules remain rigid. The time step was 2fs, calculation results was outputted once every 1 ps. all simulations were isothermal-isobaric ensemble under (NPT) carried out. All simulation was implements under the isothermal-isobaric ensemble (NPT).

[casanovaaggrev]